plko5 sgrna efs gfp vector (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
plko5 sgrna efs gfp vector
Plko5 Sgrna Efs Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko5+sgrna+efs+gfp+vector/pLKO5%2EsgRNA%2EEFS%2EGFP+(Plasmid+%2357822)/pm42823720-42-24-26
Average 94 stars, based on 122 article reviews
Plko5 Sgrna Efs Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko5+sgrna+efs+gfp+vector/pLKO5%2EsgRNA%2EEFS%2EGFP+(Plasmid+%2357822)/pm42823720-42-24-26
Average 94 stars, based on 122 article reviews
plko5 sgrna efs gfp vector - by Bioz Stars,
2026-11
94/100 stars
Images
Related Articles
Clone Assay:Article Title: Editing of highly homologous gamma-globin genes by nickase deficient Base Editor mitigates large intergenic deletions Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675-Gift from Lucas Dow). pLenti-dCas9-ABE8e-puro vector was constructed by introducing H840A mutation in the Cas9 domain of pLenti-ABE8e-puro vector. dCas9 ABE8e was similarly constructed from Addgene #138495. lentiCas9n(D10A)-Blast (Addgene #63593-gift from Feng Zhang) and lentiCRISPR v2-dCas9 (Addgene #112233-gift from Thomas Gilmore) were obtained from Addgene. .. All gRNAs were designed and cloned previously as described in Article Title: NOTCH1 signaling is dysregulated by loss of the deubiquitinase USP28 with del(11q), uncovering USP28 inhibition as novel therapeutic target in CLL Article Snippet: Generation of HG3 CRISPR/Cas9 cell lines A candidate single-guide RNA (sgRNA) targeting USP28 exon 4 was designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and selected based on its predicted ontarget efficiency and the lowest off-target effects (5’ CTCCAGTAGACTCAAAGCAA 3’). .. Moreover, a sgRNA sequence designed not to target the human genome was used as a negative control (5’ ACGGAGGCTAAGCGTCGCAA 3’). sgRNAs were cloned into the Article Title: Editing of homologous globin genes by nickase-deficient base editor mitigates large intergenic deletions in HSPCs Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described1 by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675- Gift from Lucas Dow). pLenti-dCas9-ABE8e-puro vector was constructed by introducing H840A mutation in the Cas9 domain of pLenti-ABE8e-puro vector. dCas9 ABE8e was similarly constructed from Addgene #138495. lentiCas9n(D10A)-Blast (Addgene #63593- gift from Feng Zhang) was obtained from Addgene. .. All gRNAs were designed and cloned in Article Title: Editing of homologous globin genes by nickase-deficient base editor mitigates large intergenic deletions in HSPCs Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described1 by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675- Gift from Lucas Dow). .. All gRNAs were designed and cloned in Article Title: ZNF292 mutations impair RNA and protein biosynthesis defining an adverse prognostic subset in early-stage chronic lymphocytic leukemia. Article Snippet: .. Single guide RNAs (sgRNAs) targeting exon 8 of ZNF292 (Supplementary Table S4) were designed using CRISPick (https:/ /portal s.broad inst itute.org/gppx/crispick/), cloned into the Article Title: CRISPR-Cas9 Library Screening Identifies Novel Molecular Vulnerabilities in KMT2A -Rearranged Acute Lymphoblastic Leukemia. Article Snippet: For each target gene, one or two gRNAs were chosen from the CRISPR KO screen sgRNA libraries, complemented with one or two commercially available gRNAs against the genes of interest (Supplementary Table S2, IDT). .. Each gRNA was cloned into the Plasmid Preparation:Article Title: Editing of highly homologous gamma-globin genes by nickase deficient Base Editor mitigates large intergenic deletions Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675-Gift from Lucas Dow). pLenti-dCas9-ABE8e-puro vector was constructed by introducing H840A mutation in the Cas9 domain of pLenti-ABE8e-puro vector. dCas9 ABE8e was similarly constructed from Addgene #138495. lentiCas9n(D10A)-Blast (Addgene #63593-gift from Feng Zhang) and lentiCRISPR v2-dCas9 (Addgene #112233-gift from Thomas Gilmore) were obtained from Addgene. .. All gRNAs were designed and cloned previously as described in Article Title: Lysine-specific demethylase 1 regulates hematopoietic stem cell expansion and myeloid cell differentiation Article Snippet: For CRISPR-Cas9 gene editing, THP1 and K562 cells were initially transduced with pLenti-Cas9-P2A-Puro (Addgene #110837), and cells gaining stable Cas9 expression were selected by culture in 2 μg/ml Puromycine. .. In a second step, LSD1 sgRNAs or a non-targeting sgRNA, expressed by the Article Title: NOTCH1 signaling is dysregulated by loss of the deubiquitinase USP28 with del(11q), uncovering USP28 inhibition as novel therapeutic target in CLL Article Snippet: Generation of HG3 CRISPR/Cas9 cell lines A candidate single-guide RNA (sgRNA) targeting USP28 exon 4 was designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and selected based on its predicted ontarget efficiency and the lowest off-target effects (5’ CTCCAGTAGACTCAAAGCAA 3’). .. Moreover, a sgRNA sequence designed not to target the human genome was used as a negative control (5’ ACGGAGGCTAAGCGTCGCAA 3’). sgRNAs were cloned into the Article Title: Editing of homologous globin genes by nickase-deficient base editor mitigates large intergenic deletions in HSPCs Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described1 by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675- Gift from Lucas Dow). pLenti-dCas9-ABE8e-puro vector was constructed by introducing H840A mutation in the Cas9 domain of pLenti-ABE8e-puro vector. dCas9 ABE8e was similarly constructed from Addgene #138495. lentiCas9n(D10A)-Blast (Addgene #63593- gift from Feng Zhang) was obtained from Addgene. .. All gRNAs were designed and cloned in Article Title: Editing of homologous globin genes by nickase-deficient base editor mitigates large intergenic deletions in HSPCs Article Snippet: pLenti-ABE8e-puro vector was constructed as previously described1 by inserting the base editor sequence from Addgene #138495 (Gift from David Liu) into lenti viral vector (Addgene #112675- Gift from Lucas Dow). .. All gRNAs were designed and cloned in Article Title: HDAC7 is a potential therapeutic target in acute erythroid leukemia. Article Snippet: Lentiviruses were produced by transient transfection of lentiviral plasmids along with pCMV-VSV-G (Addgene, #8454) [24] and psPAX2 (Addgene, #12260) into 293T cells using the calcium-phosphate method [25]. .. Gene depletion using the CRISPR/Cas9 system To generate short guide RNA (sgRNA) constructs, annealed oligos were inserted into pLentiguide-puro vector (#52963), pLKO5.sgRNA.EFS.tRFP657 vector (#57824) and Article Title: ZNF292 mutations impair RNA and protein biosynthesis defining an adverse prognostic subset in early-stage chronic lymphocytic leukemia. Article Snippet: .. Single guide RNAs (sgRNAs) targeting exon 8 of ZNF292 (Supplementary Table S4) were designed using CRISPick (https:/ /portal s.broad inst itute.org/gppx/crispick/), cloned into the Sequencing:Article Title: NOTCH1 signaling is dysregulated by loss of the deubiquitinase USP28 with del(11q), uncovering USP28 inhibition as novel therapeutic target in CLL Article Snippet: Generation of HG3 CRISPR/Cas9 cell lines A candidate single-guide RNA (sgRNA) targeting USP28 exon 4 was designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and selected based on its predicted ontarget efficiency and the lowest off-target effects (5’ CTCCAGTAGACTCAAAGCAA 3’). .. Moreover, a sgRNA sequence designed not to target the human genome was used as a negative control (5’ ACGGAGGCTAAGCGTCGCAA 3’). sgRNAs were cloned into the Negative Control:Article Title: NOTCH1 signaling is dysregulated by loss of the deubiquitinase USP28 with del(11q), uncovering USP28 inhibition as novel therapeutic target in CLL Article Snippet: Generation of HG3 CRISPR/Cas9 cell lines A candidate single-guide RNA (sgRNA) targeting USP28 exon 4 was designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and selected based on its predicted ontarget efficiency and the lowest off-target effects (5’ CTCCAGTAGACTCAAAGCAA 3’). .. Moreover, a sgRNA sequence designed not to target the human genome was used as a negative control (5’ ACGGAGGCTAAGCGTCGCAA 3’). sgRNAs were cloned into the Transfection:Article Title: NOTCH1 signaling is dysregulated by loss of the deubiquitinase USP28 with del(11q), uncovering USP28 inhibition as novel therapeutic target in CLL Article Snippet: Generation of HG3 CRISPR/Cas9 cell lines A candidate single-guide RNA (sgRNA) targeting USP28 exon 4 was designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and selected based on its predicted ontarget efficiency and the lowest off-target effects (5’ CTCCAGTAGACTCAAAGCAA 3’). .. Moreover, a sgRNA sequence designed not to target the human genome was used as a negative control (5’ ACGGAGGCTAAGCGTCGCAA 3’). sgRNAs were cloned into the Article Title: ZNF292 mutations impair RNA and protein biosynthesis defining an adverse prognostic subset in early-stage chronic lymphocytic leukemia. Article Snippet: .. Single guide RNAs (sgRNAs) targeting exon 8 of ZNF292 (Supplementary Table S4) were designed using CRISPick (https:/ /portal s.broad inst itute.org/gppx/crispick/), cloned into the CRISPR:Article Title: HDAC7 is a potential therapeutic target in acute erythroid leukemia. Article Snippet: Lentiviruses were produced by transient transfection of lentiviral plasmids along with pCMV-VSV-G (Addgene, #8454) [24] and psPAX2 (Addgene, #12260) into 293T cells using the calcium-phosphate method [25]. .. Gene depletion using the CRISPR/Cas9 system To generate short guide RNA (sgRNA) constructs, annealed oligos were inserted into pLentiguide-puro vector (#52963), pLKO5.sgRNA.EFS.tRFP657 vector (#57824) and Construct:Article Title: HDAC7 is a potential therapeutic target in acute erythroid leukemia. Article Snippet: Lentiviruses were produced by transient transfection of lentiviral plasmids along with pCMV-VSV-G (Addgene, #8454) [24] and psPAX2 (Addgene, #12260) into 293T cells using the calcium-phosphate method [25]. .. Gene depletion using the CRISPR/Cas9 system To generate short guide RNA (sgRNA) constructs, annealed oligos were inserted into pLentiguide-puro vector (#52963), pLKO5.sgRNA.EFS.tRFP657 vector (#57824) and |